SCF175823, SCF175823 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF175823
Genbank ID	KP278927
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)12
Primer 1	SCF175823.forward primer: AGGGGCAGTTTAGTCCTAGTAT
Primer 2	SCF175823.reverse primer: GCACGTCTTTTCTGTAGTTCAT
Max Length	231
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278927

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG2	N/A	4.88	SCF175823	View
2	Cranberry-Crimson_Queen-2007	LG2	N/A	3.4	SCF175823	View
3	Cranberry-CNJ02-1-2017	LG02	N/A	2.9	SCF175823	View
4	Cranberry-Crimson_Queen-2017	LG02	N/A	0	SCF175823	View
5	Cranberry-Composite_map-F1	LG02	N/A	97.18	SCF175823	View
6	Cranberry-Crimson_Queen-F1	LG02	N/A	96.58	SCF175823	View