scf19e, scf19e (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf19e
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf19e.forward primer: AGGGTGTCCTGAACAACTGG
Primer 2	scf19e.reverse primer: TTGGGGACTAAATGGGTTATG
Publication	[view all]

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG4	N/A	68.3	scf19e	View