scf1p, scf1p (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf1p
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf1p.forward primer: AGAGTTGCCTCGAAGTAGCG
Primer 2	scf1p.reverse primer: TGGGTGTGCTGAGTTTCTTG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr08	supercontig	Vmac_chr08:635105..635323 .
chr8	supercontig	chr8:823055..823253 .
Chr10	supercontig	Chr10:34503505..34503693 .
Chr10_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr10_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:39636966..39637154 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG4	N/A	96.3	scf1p	View
2	Cranberry-Crimson_Queen-F1	LG08	N/A	0	scf1p	View
3	Cranberry-Mullica_Queen_1-F1	LG08	N/A	0	scf1p	View
4	Cranberry-CNJ02-1-2017	LG08	N/A	92.1	scf1p	View
5	Cranberry-Crimson_Queen-2017	LG08	N/A	74	scf1p	View
6	Cranberry-Mullica_Queen-2017	LG08	N/A	107.6	scf1p	View
7	Cranberry-Composite_map-F1	LG08	N/A	1.78	scf1p	View
8	Cranberry-BB/CQ-F1	LG04	N/A	76.46	scf1p	View