scf2001, scf2001 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf2001
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf2001.forward primer: CCCTACATTTCTTACCCGGA
Primer 2scf2001.reverse primer: GGGGCCAGACCTCAATAAAT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG1N/A79.4scf2001ViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf2001.forward primerVaccinium macrocarponprimer
reverse primerscf2001.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf2001scf2001Vaccinium macrocarponmarker_locus