scf203h, scf203h (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf203h
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf203h.forward primer: AAGTTACAACGGTTCGTGGC
Primer 2scf203h.reverse primer: TGCAACATTGTGATGGTCCT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG7N/A115.99scf203hView
2Cranberry-CNJ02-1-2007LG7N/A0scf203hView
3Cranberry-Unifiedmap2013LG3N/A0scf203hView
4Cranberry-Mullica_Queen-2017LG07N/A0scf203hView
5Cranberry-Crimson_Queen-2007LG7N/A0scf203hView
6Cranberry-Crimson_Queen-2017LG07N/A0scf203hView
7Cranberry-CNJ02-1-2017LG07N/A0.2scf203hView
8Cranberry-Mullica_Queen-2007LG7N/A0scf203hView
9Cranberry-[BG//BL/BN]95-F1LG07N/A106.08scf203hView
10Cranberry-Composite_map-F1LG07N/A95.5scf203hView
11Cranberry-Crimson_Queen-F1LG07N/A87.58scf203hView
12Cranberry-Mullica_Queen_1-F1LG07N/A108.22scf203hView
13Cranberry-BB/CQ-F1LG03N/A111.05scf203hView
14Cranberry-BB/CQ-F1LG03N/A89.22scf203hView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf203h.forward primerVaccinium macrocarponprimer
reverse primerscf203h.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf203hscf203hVaccinium macrocarponmarker_locus
scf203hscf203h-106.08Vaccinium macrocarponmarker_locus
scf203hscf203h-95.5Vaccinium macrocarponmarker_locus
scf203hscf203h-87.58Vaccinium macrocarponmarker_locus
scf203hscf203h-108.22Vaccinium macrocarponmarker_locus
scf203hscf203h-111.05Vaccinium macrocarponmarker_locus
scf203hscf203h-89.215Vaccinium macrocarponmarker_locus