scf203h, scf203h (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf203h
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf203h.forward primer: AAGTTACAACGGTTCGTGGC
Primer 2	scf203h.reverse primer: TGCAACATTGTGATGGTCCT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr07	supercontig	Vmac_chr07:36856710..36856979 .
chr7	supercontig	chr7:36891693..36892038 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG7	N/A	115.99	scf203h	View
2	Cranberry-CNJ02-1-2007	LG7	N/A	0	scf203h	View
3	Cranberry-Crimson_Queen-2007	LG7	N/A	0	scf203h	View
4	Cranberry-Mullica_Queen-2007	LG7	N/A	0	scf203h	View
5	Cranberry-Unifiedmap2013	LG3	N/A	0	scf203h	View
6	Cranberry-CNJ02-1-2017	LG07	N/A	0.2	scf203h	View
7	Cranberry-Crimson_Queen-2017	LG07	N/A	0	scf203h	View
8	Cranberry-Mullica_Queen-2017	LG07	N/A	0	scf203h	View
9	Cranberry-[BG//BL/BN]95-F1	LG07	N/A	106.08	scf203h	View
10	Cranberry-Composite_map-F1	LG07	N/A	95.5	scf203h	View
11	Cranberry-Crimson_Queen-F1	LG07	N/A	87.58	scf203h	View
12	Cranberry-Mullica_Queen_1-F1	LG07	N/A	108.22	scf203h	View
13	Cranberry-BB/CQ-F1	LG03	N/A	111.05	scf203h	View
14	Cranberry-BB/CQ-F1	LG03	N/A	89.22	scf203h	View