scf207d, scf207d (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf207d
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf207d.forward primer: GACACACGTGGTGCACTGTT
Primer 2scf207d.reverse primer: GGTTGATCTTAGGAGCTGCG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG06N/A67.1scf207dView
2Cranberry-Unifiedmap2013LG5N/A32scf207dView
3Cranberry-Crimson_Queen-2007LG6N/A72.7scf207dView
4Cranberry-Mullica_Queen-2017LG06N/A82.5scf207dView
5Cranberry-CNJ02-1-2007LG6N/A82.03scf207dView
6Cranberry-CNJ02-1-2017LG06N/A75.1scf207dView
7Cranberry-Mullica_Queen-2007LG6N/A96scf207dView
8Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG6N/A28.26scf207dView
9Cranberry-[BG//BL/BN]95-F1LG06N/A23.56scf207dView
10Cranberry-Composite_map-F1LG06N/A19.74scf207dView
11Cranberry-Crimson_Queen-F1LG06N/A14.31scf207dView
12Cranberry-Mullica_Queen_1-F1LG06N/A19.7scf207dView
13Cranberry-BB/CQ-F1LG05N/A16.13scf207dView
14Cranberry-BB/CQ-F1LG05N/A73.39scf207dView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf207d.forward primerVaccinium macrocarponprimer
reverse primerscf207d.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fruit lengthqFLEN.GRYG.LG06.16Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf207dscf207dVaccinium macrocarponmarker_locus
scf207dscf207d-23.56Vaccinium macrocarponmarker_locus
scf207dscf207d-19.74Vaccinium macrocarponmarker_locus
scf207dscf207d-14.31Vaccinium macrocarponmarker_locus
scf207dscf207d-19.7Vaccinium macrocarponmarker_locus
scf207dscf207d-16.127Vaccinium macrocarponmarker_locus
scf207dscf207d-73.392Vaccinium macrocarponmarker_locus