scf207d, scf207d (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf207d
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf207d.forward primer: GACACACGTGGTGCACTGTT
Primer 2	scf207d.reverse primer: GGTTGATCTTAGGAGCTGCG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr06	supercontig	Vmac_chr06:7172743..7172989 .
chr6	supercontig	chr6:32132639..32132885 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG6	N/A	28.26	scf207d	View
2	Cranberry-CNJ02-1-2007	LG6	N/A	82.03	scf207d	View
3	Cranberry-Crimson_Queen-2007	LG6	N/A	72.7	scf207d	View
4	Cranberry-Mullica_Queen-2007	LG6	N/A	96	scf207d	View
5	Cranberry-Unifiedmap2013	LG5	N/A	32	scf207d	View
6	Cranberry-CNJ02-1-2017	LG06	N/A	75.1	scf207d	View
7	Cranberry-Crimson_Queen-2017	LG06	N/A	67.1	scf207d	View
8	Cranberry-Mullica_Queen-2017	LG06	N/A	82.5	scf207d	View
9	Cranberry-[BG//BL/BN]95-F1	LG06	N/A	23.56	scf207d	View
10	Cranberry-Composite_map-F1	LG06	N/A	19.74	scf207d	View
11	Cranberry-Crimson_Queen-F1	LG06	N/A	14.31	scf207d	View
12	Cranberry-Mullica_Queen_1-F1	LG06	N/A	19.7	scf207d	View
13	Cranberry-BB/CQ-F1	LG05	N/A	16.13	scf207d	View
14	Cranberry-BB/CQ-F1	LG05	N/A	73.39	scf207d	View