scf210, scf210 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf210
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf210.forward primer: TTTGATGGAGCCTAACAAGGA
Primer 2scf210.reverse primer: GCATATGCAGTTGTTGGTGG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG1N/A33.9scf210ViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf210.forward primerVaccinium macrocarponprimer
reverse primerscf210.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf210scf210Vaccinium macrocarponmarker_locus