scf210, scf210 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf210
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf210.forward primer: TTTGATGGAGCCTAACAAGGA
Primer 2	scf210.reverse primer: GCATATGCAGTTGTTGGTGG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr09	supercontig	Vmac_chr09:31389770..31389996 .
chr9	supercontig	chr9:10073317..10073557 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG1	N/A	33.9	scf210	View