SCF21119, SCF21119 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF21119
Genbank IDKP278654
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TA)9
Primer 1SCF21119.forward primer: GGATTTGAGGACTATACCAAGA
Primer 2SCF21119.reverse primer: TTAAAAGGCATACGCTGAC
Max Length347
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG03N/A51.7SCF21119View
2Cranberry-CNJ02-1-2007LG3N/A62.88SCF21119View
3Cranberry-Mullica_Queen-2007LG3N/A72.5SCF21119View
4Cranberry-Mullica_Queen-2017LG03N/A64.1SCF21119View
5Cranberry-CNJ02-1-2017LG03N/A57.8SCF21119View
6Cranberry-Crimson_Queen-2007LG3N/A55.7SCF21119View
7Cranberry-Composite_map-F1LG03N/A34.75SCF21119View
8Cranberry-Crimson_Queen-F1LG03N/A35.97SCF21119View
9Cranberry-Mullica_Queen_1-F1LG03N/A44.17SCF21119View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278654
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF21119.forward primerVaccinium macrocarponprimer
reverse primerSCF21119.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF21119SCF21119Vaccinium macrocarponmarker_locus
SCF21119SCF21119-34.75Vaccinium macrocarponmarker_locus
SCF21119SCF21119-35.97Vaccinium macrocarponmarker_locus
SCF21119SCF21119-44.17Vaccinium macrocarponmarker_locus