SCF21596, SCF21596 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF21596
Genbank IDKP278655
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AC)11
Primer 1SCF21596.forward primer: ATATACTGGCATAAACACCCTC
Primer 2SCF21596.reverse primer: CCTTACTCTTATCATGGCTAGG
Max Length320
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG11N/A51.3SCF21596View
2Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG11N/A54.64SCF21596View
3Cranberry-Crimson_Queen-2017LG11N/A31.6SCF21596View
4Cranberry-CNJ02-1-2007LG11N/A41.89SCF21596View
5Cranberry-CNJ02-1-2017LG11N/A42.5SCF21596View
6Cranberry-Mullica_Queen-2017LG11N/A51.3SCF21596View
7Cranberry-Crimson_Queen-2007LG11N/A36.3SCF21596View
8Cranberry-[BG//BL/BN]95-F1LG11N/A41.88SCF21596View
9Cranberry-Composite_map-F1LG11N/A39.89SCF21596View
10Cranberry-Crimson_Queen-F1LG11N/A35.28SCF21596View
11Cranberry-GH1/35-F1LG11N/A38.34SCF21596View
12Cranberry-Mullica_Queen_1-F1LG11N/A51.45SCF21596View
13Cranberry-Stevens-F1LG11N/A25.54SCF21596View
14Cranberry-BB/CQ-F1LG11N/A41.43SCF21596View
15Cranberry-BB/CQ-F1LG11N/A32.99SCF21596View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278655
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF21596.forward primerVaccinium macrocarponprimer
reverse primerSCF21596.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit weightqFWT.CNJ02-1.LG11.2011.1Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF21596SCF21596Vaccinium macrocarponmarker_locus
SCF21596SCF21596-41.88Vaccinium macrocarponmarker_locus
SCF21596SCF21596-39.89Vaccinium macrocarponmarker_locus
SCF21596SCF21596-35.28Vaccinium macrocarponmarker_locus
SCF21596SCF21596-38.34Vaccinium macrocarponmarker_locus
SCF21596SCF21596-51.45Vaccinium macrocarponmarker_locus
SCF21596SCF21596-25.54Vaccinium macrocarponmarker_locus
SCF21596SCF21596-41.427Vaccinium macrocarponmarker_locus
SCF21596SCF21596-32.987Vaccinium macrocarponmarker_locus