scf21n, scf21n (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf21n
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf21n.forward primer: ACCAATTCCCTCCCAAGTTC
Primer 2scf21n.reverse primer: CCCTGGATATTTGCTTGCAT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG1N/A35.8scf21nViewN/A
2Blueberry-F1#10-2017LG09N/A60.7scf21nViewN/A
3Cranberry-CNJ02-1-2017LG09N/A58.2scf21nViewN/A
4Cranberry-Mullica_Queen-2017LG09N/A70.7scf21nViewN/A
5Cranberry-CNJ02-1-2007LG9N/A60.75scf21nViewN/A
6Cranberry-Crimson_Queen-2007LG9N/A56.1scf21nViewN/A
7Cranberry-Mullica_Queen-2007LG9N/A73.2scf21nViewN/A
8Blueberry-W85-23-2017LG09N/A56.2scf21nViewN/A
9Blueberry-F1#10_x_W85-23-F1-2017LG09N/A26.4scf21nViewN/A
10Cranberry-Crimson_Queen-2017LG09N/A47.8scf21nViewN/A
11Cranberry-Composite_map-F1LG09N/A31.29scf21nViewN/A
12Cranberry-Crimson_Queen-F1LG09N/A23.89scf21nViewN/A
13Cranberry-Mullica_Queen_1-F1LG09N/A36.4scf21nViewN/A
14Cranberry-Mullica_Queen_2-F1LG09N/A40.12scf21nViewN/A
15Cranberry-Stevens-F1LG09N/A21.23scf21nViewN/A
16Cranberry-BB/CQ-F1LG01N/A38.39scf21nViewN/A
17Cranberry-BB/CQ-F1LG01N/A28.15scf21nViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf21n.forward primerVaccinium macrocarponprimer
reverse primerscf21n.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf21nscf21nVaccinium macrocarponmarker_locus
scf21nscf21n-31.29Vaccinium macrocarponmarker_locus
scf21nscf21n-23.89Vaccinium macrocarponmarker_locus
scf21nscf21n-36.4Vaccinium macrocarponmarker_locus
scf21nscf21n-40.12Vaccinium macrocarponmarker_locus
scf21nscf21n-21.23Vaccinium macrocarponmarker_locus
scf21nscf21n-38.386Vaccinium macrocarponmarker_locus
scf21nscf21n-28.15Vaccinium macrocarponmarker_locus