scf21n, scf21n (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf21n
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf21n.forward primer: ACCAATTCCCTCCCAAGTTC
Primer 2	scf21n.reverse primer: CCCTGGATATTTGCTTGCAT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr06	supercontig	Vcev1_p0.Chr06:41631114..41631323 .
scaffold00017	supercontig	scaffold00017:140084..140293 .
chr6_H1	supercontig	chr6_H1:34369235..34369462 .
Vmac_chr09	supercontig	Vmac_chr09:30806905..30807130 .
chr9	supercontig	chr9:10650627..10650854 .
Chr06	supercontig	Chr06:10264291..10264514 .
Chr06_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr06_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:11346266..11346509 .
Chr06_Vaccinium_vitis-idaea_ssp_minus	chromosome	Chr06_Vaccinium_vitis-idaea_ssp_minus:10920277..10920514 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG9	N/A	60.75	scf21n	View
2	Cranberry-Crimson_Queen-2007	LG9	N/A	56.1	scf21n	View
3	Cranberry-Mullica_Queen-2007	LG9	N/A	73.2	scf21n	View
4	Cranberry-Unifiedmap2013	LG1	N/A	35.8	scf21n	View
5	Blueberry-F1#10_x_W85-23-F1-2017	LG09	N/A	26.4	scf21n	View
6	Blueberry-F1#10-2017	LG09	N/A	60.7	scf21n	View
7	Blueberry-W85-23-2017	LG09	N/A	56.2	scf21n	View
8	Cranberry-CNJ02-1-2017	LG09	N/A	58.2	scf21n	View
9	Cranberry-Crimson_Queen-2017	LG09	N/A	47.8	scf21n	View
10	Cranberry-Mullica_Queen-2017	LG09	N/A	70.7	scf21n	View
11	Cranberry-Composite_map-F1	LG09	N/A	31.29	scf21n	View
12	Cranberry-Crimson_Queen-F1	LG09	N/A	23.89	scf21n	View
13	Cranberry-Mullica_Queen_1-F1	LG09	N/A	36.4	scf21n	View
14	Cranberry-Mullica_Queen_2-F1	LG09	N/A	40.12	scf21n	View
15	Cranberry-Stevens-F1	LG09	N/A	21.23	scf21n	View
16	Cranberry-BB/CQ-F1	LG01	N/A	38.39	scf21n	View
17	Cranberry-BB/CQ-F1	LG01	N/A	28.15	scf21n	View