SCF22434, SCF22434 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF22434
Genbank IDKP278656
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)9
Primer 1SCF22434.forward primer: TATGTATAGTCCCACAACAAGG
Primer 2SCF22434.reverse primer: TCCTGTCTATCACTCACATCAC
Max Length265
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG02N/A112.3SCF22434View
2Cranberry-Mullica_Queen-2007LG2N/A117.6SCF22434View
3Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG2N/A113.79SCF22434View
4Cranberry-CNJ02-1-2017LG02N/A102.7SCF22434View
5Cranberry-CNJ02-1-2007LG2N/A106.5SCF22434View
6Cranberry-[BG//BL/BN]95-F1LG02N/A0SCF22434View
7Cranberry-Composite_map-F1LG02N/A1.79SCF22434View
8Cranberry-Mullica_Queen_1-F1LG02N/A0.6SCF22434View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278656
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF22434.forward primerVaccinium macrocarponprimer
reverse primerSCF22434.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF22434SCF22434Vaccinium macrocarponmarker_locus
SCF22434SCF22434-1.79Vaccinium macrocarponmarker_locus
SCF22434SCF22434-0.6Vaccinium macrocarponmarker_locus