SCF22477, SCF22477 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF22477
Genbank ID	KP278658
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)12
Primer 1	SCF22477.forward primer: CTCTCCCCTACTTTCTTCCTAT
Primer 2	SCF22477.reverse primer: GCCGCTAACACAATTAACTAAC
Max Length	247
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278658

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr03	supercontig	Vmac_chr03:21906026..21906244 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG3	N/A	61.68	SCF22477	View
2	Cranberry-Crimson_Queen-2007	LG3	N/A	54.7	SCF22477	View
3	Cranberry-CNJ02-1-2017	LG03	N/A	56.9	SCF22477	View
4	Cranberry-Crimson_Queen-2017	LG03	N/A	50.8	SCF22477	View
5	Cranberry-Composite_map-F1	LG03	N/A	35.34	SCF22477	View
6	Cranberry-Crimson_Queen-F1	LG03	N/A	36.56	SCF22477	View