scf22m, scf22m (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf22m
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(ct)19
Primer 1scf22m.forward primer: TAACTTCACTAGCCCACCCG
Primer 2scf22m.reverse primer: AGGGTTTAGGCACTTAGGACA
Max Length423
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Unifiedmap2013LG4N/A57.9scf22mView
2Cranberry-BB/CQ-F1LG04N/A50.61scf22mView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf22m.forward primerVaccinium macrocarponprimer
reverse primerscf22m.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf22mscf22mVaccinium macrocarponmarker_locus
scf22mscf22m-50.611Vaccinium macrocarponmarker_locus