SCF183590, SCF183590 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF183590
Genbank IDKP278933
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)11
Primer 1SCF183590.forward primer: TTTGTAGTATGGGGACACTGAT
Primer 2SCF183590.reverse primer: AAAGAGGCAGGTCAGAAAAT
Max Length173
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG11N/A37.5SCF183590View
2Cranberry-Crimson_Queen-2017LG11N/A31.1SCF183590View
3Cranberry-CNJ02-1-2017LG11N/A37.9SCF183590View
4Cranberry-[BG//BL/BN]95-F1LG11N/A40.18SCF183590View
5Cranberry-Crimson_Queen-F1LG11N/A32.89SCF183590View
6Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG11N/A51.3SCF183590View
7Cranberry-Crimson_Queen-2007LG11N/A33.4SCF183590View
8Cranberry-CNJ02-1-2007LG11N/A37.75SCF183590View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278933
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF183590.forward primerVaccinium macrocarponprimer
reverse primerSCF183590.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF183590SCF183590Vaccinium macrocarponmarker_locus
SCF183590SCF183590-40.18Vaccinium macrocarponmarker_locus
SCF183590SCF183590-37.5Vaccinium macrocarponmarker_locus
SCF183590SCF183590-32.89Vaccinium macrocarponmarker_locus