SCF26049, SCF26049 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDKP278668
SpeciesVaccinium macrocarpon
Repeat Motif(TTC)13
Primer 1SCF26049.forward primer: GTTCAGGTCTGTTGTAAGGAAG
Primer 2SCF26049.reverse primer: TTTCTTGTAGGACGAAGTGG
Max Length187
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
External references for this genetic_marker

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF26049.forward primerVaccinium macrocarponprimer
reverse primerSCF26049.reverse primerVaccinium macrocarponprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF26049SCF26049Vaccinium macrocarponmarker_locus
SCF26049SCF26049-13.99Vaccinium macrocarponmarker_locus
SCF26049SCF26049-24.34Vaccinium macrocarponmarker_locus
SCF26049SCF26049-19.83Vaccinium macrocarponmarker_locus