scf23c, scf23c (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf23c
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf23c.forward primer: TCCTCAGCACACGTCAATTC
Primer 2	scf23c.reverse primer: GCAGTAAGGACCGAGATCCA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff21	supercontig	VaccDscaff21:30461683..30461891 .
Vmac_chr02	supercontig	Vmac_chr02:33639863..33640032 .
chr2	supercontig	chr2:32070864..32071039 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG8	N/A	71.6	scf23c	View
2	Cranberry-BB/CQ-F1	LG08	N/A	77.2	scf23c	View
3	Cranberry-BB/CQ-F1	LG08	N/A	16.74	scf23c	View