SCF18363, SCF18363 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF18363
Genbank IDKP278650
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)10
Primer 1SCF18363.forward primer: CAAAGACCGCTAGGTTTACA
Primer 2SCF18363.reverse primer: ACTGCTCACTAGACAAGATCG
Max Length176
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG4N/A102SCF18363View
2Blueberry-F1#10-2017LG04N/A101.2SCF18363View
3Cranberry-CNJ02-1-2017LG04N/A98.2SCF18363View
4Blueberry-F1#10_x_W85-23-F1-2017LG04N/A86.7SCF18363View
5Cranberry-CNJ02-1-2007LG4N/A95.71SCF18363View
6Cranberry-Mullica_Queen-2017LG04N/A109.8SCF18363View
7Cranberry-Composite_map-F1LG04N/A84.57SCF18363View
8Cranberry-GH1/35-F1LG04N/A84.11SCF18363View
9Cranberry-Mullica_Queen_1-F1LG04N/A112.12SCF18363View
10Cranberry-Stevens-F1LG04N/A55.61SCF18363View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278650
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF18363.forward primerVaccinium macrocarponprimer
reverse primerSCF18363.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF18363SCF18363Vaccinium macrocarponmarker_locus
SCF18363SCF18363-84.57Vaccinium macrocarponmarker_locus
SCF18363SCF18363-84.11Vaccinium macrocarponmarker_locus
SCF18363SCF18363-112.12Vaccinium macrocarponmarker_locus
SCF18363SCF18363-55.61Vaccinium macrocarponmarker_locus