SCF24087, SCF24087 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF24087
Genbank IDKP278663
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CTT)11
Primer 1SCF24087.forward primer: GTCCCTTTCTCGTGTCTTTAT
Primer 2SCF24087.reverse primer: GAGTAGTGACGATGCAACTAGA
Max Length212
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2007LG8N/A0.9SCF24087ViewN/A
2Blueberry-W85-23-2017LG08N/A8.5SCF24087ViewN/A
3Cranberry-CNJ02-1-2017LG08N/A0SCF24087ViewN/A
4Blueberry-F1#10-2017LG08N/A6.2SCF24087ViewN/A
5Cranberry-Mullica_Queen-2017LG08N/A0SCF24087ViewN/A
6Blueberry-F1#10_x_W85-23-F1-2017LG08N/A6.8SCF24087ViewN/A
7Cranberry-CNJ02-1-2007LG8N/A1.08SCF24087ViewN/A
8Cranberry-Composite_map-F1LG08N/A84.69SCF24087ViewN/A
9Cranberry-Mullica_Queen_1-F1LG08N/A110.28SCF24087ViewN/A
10Cranberry-Mullica_Queen_2-F1LG08N/A88.6SCF24087ViewN/A
11Cranberry-BB/CQ-F1LG04N/A2.94SCF24087ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278663
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF24087.forward primerVaccinium macrocarponprimer
reverse primerSCF24087.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF24087SCF24087Vaccinium macrocarponmarker_locus
SCF24087SCF24087-84.69Vaccinium macrocarponmarker_locus
SCF24087SCF24087-110.28Vaccinium macrocarponmarker_locus
SCF24087SCF24087-88.6Vaccinium macrocarponmarker_locus
SCF24087SCF24087-2.944Vaccinium macrocarponmarker_locus