scf248, scf248 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf248
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf248.forward primer: CAACTGGAGGCAAAACAACA
Primer 2scf248.reverse primer: CACGCATTGCAATTATACCG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG12N/A5scf248View
2Cranberry-Crimson_Queen-2017LG12N/A0.9scf248View
3Cranberry-CNJ02-1-2017LG12N/A2.6scf248View
4Cranberry-Crimson_Queen-2007LG12N/A8.4scf248View
5Cranberry-CNJ02-1-2007LG12N/A6.07scf248View
6Cranberry-Mullica_Queen-2007LG12N/A6.3scf248View
7Cranberry-Unifiedmap2013LG6N/A44.1scf248View
8Cranberry-Composite_map-F1LG12N/A85.12scf248View
9Cranberry-Crimson_Queen-F1LG12N/A60.91scf248View
10Cranberry-Mullica_Queen_1-F1LG12N/A98.14scf248View
11Cranberry-BB/CQ-F1LG06N/A5.74scf248View
12Cranberry-BB/CQ-F1LG06N/A5.77scf248View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf248.forward primerVaccinium macrocarponprimer
reverse primerscf248.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf248scf248Vaccinium macrocarponmarker_locus
scf248scf248-85.12Vaccinium macrocarponmarker_locus
scf248scf248-60.91Vaccinium macrocarponmarker_locus
scf248scf248-98.14Vaccinium macrocarponmarker_locus
scf248scf248-5.738Vaccinium macrocarponmarker_locus
scf248scf248-5.768Vaccinium macrocarponmarker_locus