scf275d, scf275d (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf275d
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf275d.forward primer: GCTTTTCTGAAGCGATTTGC
Primer 2scf275d.reverse primer: CCGCATACACGGCGTACTA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG1N/A52.9scf275dViewN/A
2Cranberry-CNJ02-1-2017LG09N/A44.3scf275dViewN/A
3Cranberry-Crimson_Queen-2007LG9N/A46.1scf275dViewN/A
4Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG9N/A64.12scf275dViewN/A
5Cranberry-Crimson_Queen-2017LG09N/A37.3scf275dViewN/A
6Cranberry-Mullica_Queen-2017LG09N/A51.9scf275dViewN/A
7Cranberry-Mullica_Queen-2007LG9N/A63.1scf275dViewN/A
8Cranberry-CNJ02-1-2007LG9N/A50.74scf275dViewN/A
9Cranberry-Composite_map-F1LG09N/A47.18scf275dViewN/A
10Cranberry-Crimson_Queen-F1LG09N/A32.24scf275dViewN/A
11Cranberry-Mullica_Queen_1-F1LG09N/A48.92scf275dViewN/A
12Cranberry-BB/CQ-F1LG01N/A50.12scf275dViewN/A
13Cranberry-BB/CQ-F1LG01N/A43.29scf275dViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf275d.forward primerVaccinium macrocarponprimer
reverse primerscf275d.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf275dscf275dVaccinium macrocarponmarker_locus
scf275dscf275d-47.18Vaccinium macrocarponmarker_locus
scf275dscf275d-32.24Vaccinium macrocarponmarker_locus
scf275dscf275d-48.92Vaccinium macrocarponmarker_locus
scf275dscf275d-50.124Vaccinium macrocarponmarker_locus
scf275dscf275d-43.289Vaccinium macrocarponmarker_locus