scf2505a, scf2505a (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf2505a
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf2505a.forward primer: CCAGAGAGAAGGGGGAAATC
Primer 2scf2505a.reverse primer: TTATCCCGCCGCTTAGTAGA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG08N/A82.9scf2505aView
2Cranberry-Crimson_Queen-2017LG08N/A70.2scf2505aView
3Cranberry-CNJ02-1-2007LG8N/A81.75scf2505aView
4Cranberry-Unifiedmap2013LG4N/A80.6scf2505aView
5Cranberry-Crimson_Queen-2007LG8N/A74scf2505aView
6Cranberry-Mullica_Queen-2007LG8N/A94.9scf2505aView
7Cranberry-Composite_map-F1LG08N/A10.91scf2505aView
8Cranberry-Crimson_Queen-F1LG08N/A2.38scf2505aView
9Cranberry-GH1/35-F1LG08N/A6.04scf2505aView
10Cranberry-Mullica_Queen_1-F1LG08N/A15.81scf2505aView
11Cranberry-Mullica_Queen_2-F1LG08N/A28.71scf2505aView
12Cranberry-Stevens-F1LG08N/A5.98scf2505aView
13Cranberry-BB/CQ-F1LG04N/A81.33scf2505aView
14Cranberry-BB/CQ-F1LG04N/A69.57scf2505aView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf2505a.forward primerVaccinium macrocarponprimer
reverse primerscf2505a.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf2505ascf2505aVaccinium macrocarponmarker_locus
scf2505ascf2505a-10.91Vaccinium macrocarponmarker_locus
scf2505ascf2505a-2.38Vaccinium macrocarponmarker_locus
scf2505ascf2505a-6.04Vaccinium macrocarponmarker_locus
scf2505ascf2505a-15.81Vaccinium macrocarponmarker_locus
scf2505ascf2505a-28.71Vaccinium macrocarponmarker_locus
scf2505ascf2505a-5.98Vaccinium macrocarponmarker_locus
scf2505ascf2505a-81.326Vaccinium macrocarponmarker_locus
scf2505ascf2505a-69.566Vaccinium macrocarponmarker_locus