SCF28279, SCF28279 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF28279
Genbank IDKP278675
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)12
Primer 1SCF28279.forward primer: GATACTTTACCTCCTCCTCAAG
Primer 2SCF28279.reverse primer: TTGTCCTCTATCTCTAACTCCC
Max Length239
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG12N/A73.1SCF28279View
2Blueberry-F1#10-2017LG12N/A93.3SCF28279View
3Cranberry-Mullica_Queen-2017LG12N/A87.1SCF28279View
4Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG12N/A4.19SCF28279View
5Cranberry-CNJ02-1-2007LG12N/A77.25SCF28279View
6Blueberry-W85-23-2017LG12N/A109.3SCF28279View
7Cranberry-Mullica_Queen-2007LG12N/A94.1SCF28279View
8Blueberry-F1#10_x_W85-23-F1-2017LG12N/A89SCF28279View
9Cranberry-[BG//BL/BN]95-F1LG12N/A2.27SCF28279View
10Cranberry-Composite_map-F1LG12N/A2.84SCF28279View
11Cranberry-GH1/35-F1LG12N/A2.84SCF28279View
12Cranberry-Mullica_Queen_1-F1LG12N/A2.98SCF28279View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278675
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF28279.forward primerVaccinium macrocarponprimer
reverse primerSCF28279.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF28279SCF28279Vaccinium macrocarponmarker_locus
SCF28279SCF28279-2.27Vaccinium macrocarponmarker_locus
SCF28279SCF28279-2.84Vaccinium macrocarponmarker_locus
SCF28279SCF28279-2.98Vaccinium macrocarponmarker_locus