scf27l, scf27l (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf27l
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(ag)12
Primer 1scf27l.forward primer: GATTCAGGCCAAGAATTCCA
Primer 2scf27l.reverse primer: CACACACAGGACAAAGCCAC
Max Length290
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Unifiedmap2013LG5N/A48.4scf27lView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf27l.forward primerVaccinium macrocarponprimer
reverse primerscf27l.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf27lscf27lVaccinium macrocarponmarker_locus