SCF25221, SCF25221 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF25221
Genbank ID	KP278664
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)10
Primer 1	SCF25221.forward primer: GTATCCCCACACTTACCACTAT
Primer 2	SCF25221.reverse primer: AGGATTGGACGGTAGCTTA
Max Length	331
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278664

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr07	supercontig	Vmac_chr07:10489885..10490177 .
chr7	supercontig	chr7:9988159..9988457 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG7	N/A	67.78	SCF25221	View
2	Cranberry-Crimson_Queen-2007	LG7	N/A	60.8	SCF25221	View
3	Cranberry-Mullica_Queen-2007	LG7	N/A	77.5	SCF25221	View
4	Cranberry-CNJ02-1-2017	LG07	N/A	62	SCF25221	View
5	Cranberry-Crimson_Queen-2017	LG07	N/A	58.2	SCF25221	View
6	Cranberry-Mullica_Queen-2017	LG07	N/A	70.4	SCF25221	View
7	Cranberry-Composite_map-F1	LG07	N/A	25.82	SCF25221	View
8	Cranberry-Crimson_Queen-F1	LG07	N/A	30.4	SCF25221	View
9	Cranberry-GH1/35-F1	LG07	N/A	20.54	SCF25221	View
10	Cranberry-Mullica_Queen_1-F1	LG07	N/A	30.45	SCF25221	View