scf283b, scf283b (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf283b
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf283b.forward primer: CCCGATCGAAATAAGGAACA
Primer 2scf283b.reverse primer: ATTGACGACCCAGACTCCAC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG6N/A99.1scf283bView
2Cranberry-Crimson_Queen-2007LG6N/A74.1scf283bView
3Cranberry-CNJ02-1-2017LG06N/A77.2scf283bView
4Cranberry-Unifiedmap2013LG5N/A28.4scf283bView
5Cranberry-Mullica_Queen-2017LG06N/A86.7scf283bView
6Cranberry-CNJ02-1-2007LG6N/A84.39scf283bView
7Cranberry-Crimson_Queen-2017LG06N/A67.1scf283bView
8Cranberry-Composite_map-F1LG06N/A16.85scf283bView
9Cranberry-Crimson_Queen-F1LG06N/A12.53scf283bView
10Cranberry-Mullica_Queen_1-F1LG06N/A16.73scf283bView
11Cranberry-Mullica_Queen_2-F1LG06N/A17.96scf283bView
12Cranberry-Stevens-F1LG06N/A16.46scf283bView
13Cranberry-BB/CQ-F1LG05N/A75.42scf283bView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf283b.forward primerVaccinium macrocarponprimer
reverse primerscf283b.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf283bscf283bVaccinium macrocarponmarker_locus
scf283bscf283b-16.85Vaccinium macrocarponmarker_locus
scf283bscf283b-12.53Vaccinium macrocarponmarker_locus
scf283bscf283b-16.73Vaccinium macrocarponmarker_locus
scf283bscf283b-17.96Vaccinium macrocarponmarker_locus
scf283bscf283b-16.46Vaccinium macrocarponmarker_locus
scf283bscf283b-75.417Vaccinium macrocarponmarker_locus