SCF30167, SCF30167 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF30167
Genbank ID	KP278999
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)11
Primer 1	SCF30167.forward primer: AGACATACGAAGTCCATGAAAC
Primer 2	SCF30167.reverse primer: CACCCATAACTCACCTCTAATC
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278999

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr10	supercontig	Vmac_chr10:28450534..28450929 .
chr10	supercontig	chr10:27520616..27520949 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.