scf306f, scf306f (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf306f
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf306f.forward primer: GGGCAAGGATAAAGGGTTGT
Primer 2scf306f.reverse primer: TGCATGCAACTTCCTAGTCCT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Blueberry-F1#10_x_W85-23-F1-2017LG09N/A45scf306fViewN/A
2Cranberry-Crimson_Queen-2017LG09N/A63.8scf306fViewN/A
3Blueberry-F1#10-2017LG09N/A79.5scf306fViewN/A
4Cranberry-Crimson_Queen-2007LG9N/A72.4scf306fViewN/A
5Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG9N/A95.73scf306fViewN/A
6Blueberry-W85-23-2017LG09N/A72.4scf306fViewN/A
7Cranberry-Unifiedmap2013LG1N/A17.1scf306fViewN/A
8Cranberry-CNJ02-1-2007LG9N/A79.96scf306fViewN/A
9Cranberry-CNJ02-1-2017LG09N/A74.1scf306fViewN/A
10Cranberry-[BG//BL/BN]95-F1LG09N/A14.78scf306fViewN/A
11Cranberry-Composite_map-F1LG09N/A13.31scf306fViewN/A
12Cranberry-Crimson_Queen-F1LG09N/A7.74scf306fViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf306f.forward primerVaccinium macrocarponprimer
reverse primerscf306f.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf306fscf306fVaccinium macrocarponmarker_locus
scf306fscf306f-14.78Vaccinium macrocarponmarker_locus
scf306fscf306f-13.31Vaccinium macrocarponmarker_locus
scf306fscf306f-7.74Vaccinium macrocarponmarker_locus