SCF32727, SCF32727 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF32727
Genbank IDKP278689
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)18
Primer 1SCF32727.forward primer: ATGTAACGGTCTCCACTTTCT
Primer 2SCF32727.reverse primer: TAGTATCTTCGTGGTCAGAGGT
Max Length210
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG05N/A9.8SCF32727View
2Cranberry-Crimson_Queen-2007LG5N/A9.9SCF32727View
3Cranberry-Mullica_Queen-2007LG5N/A17.9SCF32727View
4Cranberry-CNJ02-1-2007LG5N/A13.07SCF32727View
5Cranberry-CNJ02-1-2017LG05N/A12.5SCF32727View
6Blueberry-W85-23-2017LG05N/A11.4SCF32727View
7Cranberry-Mullica_Queen-2017LG05N/A17SCF32727View
8Blueberry-F1#10_x_W85-23-F1-2017LG05N/A15SCF32727View
9Blueberry-F1#10-2017LG05N/A17SCF32727View
10Cranberry-GH1/35-F1LG05N/A12.51SCF32727View
11Cranberry-Composite_map-F1LG05N/A12.51SCF32727View
12Cranberry-Crimson_Queen-F1LG05N/A6.55SCF32727View
13Cranberry-Mullica_Queen_1-F1LG05N/A14.92SCF32727View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278689
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF32727.forward primerVaccinium macrocarponprimer
reverse primerSCF32727.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF32727SCF32727Vaccinium macrocarponmarker_locus
SCF32727SCF32727-12.51Vaccinium macrocarponmarker_locus
SCF32727SCF32727-6.55Vaccinium macrocarponmarker_locus
SCF32727SCF32727-14.92Vaccinium macrocarponmarker_locus