SCF32769, SCF32769 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF32769
Genbank ID	KP279003
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(AG)13
Primer 1	SCF32769.forward primer: CTTACTGCCTTACATCCTCTTT
Primer 2	SCF32769.reverse primer: CTGGCAAATAGCTTACAGAAC
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279003

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold03520	supercontig	scaffold03520:1756..2047 .
chr4_H1	supercontig	chr4_H1:3567058..3567366 .
Vmac_chr11	supercontig	Vmac_chr11:3527264..3527567 .
chr11	supercontig	chr11:2930987..2931305 .
Chr04	supercontig	Chr04:3550625..3550939 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.