scf2882, scf2882 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf2882
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf2882.forward primer: CGCTACCATTGTCAGCTTCA
Primer 2	scf2882.reverse primer: ACACTCAAAAGCAGGTGGCT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr12	supercontig	Vmac_chr12:3878873..3879188 .
chr12	supercontig	chr12:3699347..3699658 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG12	N/A	71.61	scf2882	View
2	Cranberry-Crimson_Queen-2007	LG12	N/A	62.7	scf2882	View
3	Cranberry-Unifiedmap2013	LG12	N/A	3.5	scf2882	View
4	Cranberry-CNJ02-1-2017	LG12	N/A	49.8	scf2882	View
5	Cranberry-Crimson_Queen-2017	LG12	N/A	41	scf2882	View
6	Cranberry-Composite_map-F1	LG12	N/A	9.82	scf2882	View
7	Cranberry-Crimson_Queen-F1	LG12	N/A	4.76	scf2882	View
8	Cranberry-BB/CQ-F1	LG06	N/A	80.72	scf2882	View
9	Cranberry-BB/CQ-F1	LG12	N/A	68.44	scf2882	View
10	Cranberry-BB/CQ-F1	LG06	N/A	69.47	scf2882	View
11	Cranberry-BB/CQ-F1	LG12	N/A	14.42	scf2882	View