SCF31208, SCF31208 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF31208
Genbank IDKP278687
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)10
Primer 1SCF31208.forward primer: AACAGCACCACTACAACACTT
Primer 2SCF31208.reverse primer: AGAGAACAATCGTCTAATCGTC
Max Length359
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2017LG05N/A18.5SCF31208ViewN/A
2Cranberry-CNJ02-1-2017LG05N/A23.1SCF31208ViewN/A
3Cranberry-Crimson_Queen-2007LG5N/A20SCF31208ViewN/A
4Cranberry-Mullica_Queen-2017LG05N/A30.7SCF31208ViewN/A
5Cranberry-CNJ02-1-2007LG5N/A25.81SCF31208ViewN/A
6Cranberry-Mullica_Queen-2007LG5N/A34.3SCF31208ViewN/A
7Cranberry-Composite_map-F1LG05N/A25.19SCF31208ViewN/A
8Cranberry-Crimson_Queen-F1LG05N/A18.6SCF31208ViewN/A
9Cranberry-Mullica_Queen_1-F1LG05N/A29.27SCF31208ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278687
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF31208.forward primerVaccinium macrocarponprimer
reverse primerSCF31208.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF31208SCF31208Vaccinium macrocarponmarker_locus
SCF31208SCF31208-25.19Vaccinium macrocarponmarker_locus
SCF31208SCF31208-18.6Vaccinium macrocarponmarker_locus
SCF31208SCF31208-29.27Vaccinium macrocarponmarker_locus