scf32j, scf32j (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf32j
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf32j.forward primer: ATCCACCAAACAAGCCACAT
Primer 2scf32j.reverse primer: TCAATCAACGCGATTCCATA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2007LG9N/A98.1scf32jViewN/A
2Cranberry-CNJ02-1-2007LG9N/A82.53scf32jViewN/A
3Cranberry-Unifiedmap2013LG1N/A13.1scf32jViewN/A
4Cranberry-Mullica_Queen-2017LG09N/A87.7scf32jViewN/A
5Cranberry-CNJ02-1-2017LG09N/A75.2scf32jViewN/A
6Cranberry-Composite_map-F1LG09N/A8.81scf32jViewN/A
7Cranberry-Mullica_Queen_1-F1LG09N/A10.74scf32jViewN/A
8Cranberry-Mullica_Queen_2-F1LG09N/A14.09scf32jViewN/A
9Cranberry-BB/CQ-F1LG01N/A19.14scf32jViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf32j.forward primerVaccinium macrocarponprimer
reverse primerscf32j.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf32jscf32jVaccinium macrocarponmarker_locus
scf32jscf32j-8.81Vaccinium macrocarponmarker_locus
scf32jscf32j-10.74Vaccinium macrocarponmarker_locus
scf32jscf32j-14.09Vaccinium macrocarponmarker_locus
scf32jscf32j-19.144Vaccinium macrocarponmarker_locus