scf32j, scf32j (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf32j
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf32j.forward primer: ATCCACCAAACAAGCCACAT
Primer 2	scf32j.reverse primer: TCAATCAACGCGATTCCATA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr09	supercontig	Vmac_chr09:36816215..36816331 .
chr9	supercontig	chr9:4692127..4692243 .
Chr06	supercontig	Chr06:4513516..4513655 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG9	N/A	82.53	scf32j	View
2	Cranberry-Mullica_Queen-2007	LG9	N/A	98.1	scf32j	View
3	Cranberry-Unifiedmap2013	LG1	N/A	13.1	scf32j	View
4	Cranberry-CNJ02-1-2017	LG09	N/A	75.2	scf32j	View
5	Cranberry-Mullica_Queen-2017	LG09	N/A	87.7	scf32j	View
6	Cranberry-Composite_map-F1	LG09	N/A	8.81	scf32j	View
7	Cranberry-Mullica_Queen_1-F1	LG09	N/A	10.74	scf32j	View
8	Cranberry-Mullica_Queen_2-F1	LG09	N/A	14.09	scf32j	View
9	Cranberry-BB/CQ-F1	LG01	N/A	19.14	scf32j	View