SCF28931, SCF28931 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF28931
Genbank IDKP278678
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)13
Primer 1SCF28931.forward primer: TCTCATAAGTCAGAACCTCACA
Primer 2SCF28931.reverse primer: CTAAACTAAACCTCCTAACCGA
Max Length229
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG11N/A54.3SCF28931View
2Cranberry-Crimson_Queen-2007LG11N/A65.9SCF28931View
3Cranberry-CNJ02-1-2017LG11N/A63.4SCF28931View
4Cranberry-CNJ02-1-2007LG11N/A72.5SCF28931View
5Cranberry-Composite_map-F1LG11N/A73.75SCF28931View
6Cranberry-Crimson_Queen-F1LG11N/A69.88SCF28931View
7Cranberry-Stevens-F1LG11N/A42.29SCF28931View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278678
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF28931.forward primerVaccinium macrocarponprimer
reverse primerSCF28931.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF28931SCF28931Vaccinium macrocarponmarker_locus
SCF28931SCF28931-73.75Vaccinium macrocarponmarker_locus
SCF28931SCF28931-69.88Vaccinium macrocarponmarker_locus
SCF28931SCF28931-42.29Vaccinium macrocarponmarker_locus