SCF28955, SCF28955 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF28955
Genbank IDKP278679
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GT)9
Primer 1SCF28955.forward primer: TATTCAAAGCCACTAGGCAC
Primer 2SCF28955.reverse primer: CAAACCAAATTCTCCTTCTG
Max Length246
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG12N/A77.36SCF28955View
2Cranberry-Crimson_Queen-2007LG12N/A67.8SCF28955View
3Cranberry-Mullica_Queen-2017LG12N/A87.1SCF28955View
4Cranberry-Crimson_Queen-F1LG12N/A0SCF28955View
5Cranberry-Mullica_Queen-2007LG12N/A94.1SCF28955View
6Cranberry-CNJ02-1-2017LG12N/A71.8SCF28955View
7Cranberry-Crimson_Queen-2017LG12N/A59.1SCF28955View
8Cranberry-Composite_map-F1LG12N/A5.82SCF28955View
9Cranberry-Mullica_Queen_1-F1LG12N/A2.98SCF28955View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278679
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF28955.forward primerVaccinium macrocarponprimer
reverse primerSCF28955.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF28955SCF28955Vaccinium macrocarponmarker_locus
SCF28955SCF28955-5.82Vaccinium macrocarponmarker_locus
SCF28955SCF28955-2.98Vaccinium macrocarponmarker_locus