SCF3191, SCF3191 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDKP278603
SpeciesVaccinium macrocarpon
Repeat Motif(TCT)15
Primer 1SCF3191.forward primer: GCACTATCAGGAAGAGGAATTA
Primer 2SCF3191.reverse primer: GTAACACCAGAAAACAACTGC
Max Length260
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG12N/A119.25SCF3191ViewN/A
External references for this genetic_marker

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF3191.forward primerVaccinium macrocarponprimer
reverse primerSCF3191.reverse primerVaccinium macrocarponprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF3191SCF3191Vaccinium macrocarponmarker_locus
SCF3191SCF3191-86.61Vaccinium macrocarponmarker_locus
SCF3191SCF3191-60.91Vaccinium macrocarponmarker_locus
SCF3191SCF3191-88.81Vaccinium macrocarponmarker_locus
SCF3191SCF3191-102.32Vaccinium macrocarponmarker_locus