SCF33185, SCF33185 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF33185
Genbank ID	KP278691
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)14
Primer 1	SCF33185.forward primer: AGCACACTACAGACAGGGTAAT
Primer 2	SCF33185.reverse primer: GTTTTGGCTCTGGCTAAGTAT
Max Length	202
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278691

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr09	supercontig	Vmac_chr09:37385645..37385818 .
chr9	supercontig	chr9:4133864..4134035 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG9	N/A	101.86	SCF33185	View
2	Cranberry-CNJ02-1-2007	LG9	N/A	85.12	SCF33185	View
3	Cranberry-Crimson_Queen-2007	LG9	N/A	77.1	SCF33185	View
4	Blueberry-F1#10_x_W85-23-F1-2017	LG09	N/A	57.9	SCF33185	View
5	Blueberry-F1#10-2017	LG09	N/A	88	SCF33185	View
6	Blueberry-W85-23-2017	LG09	N/A	89.5	SCF33185	View
7	Cranberry-CNJ02-1-2017	LG09	N/A	78.9	SCF33185	View
8	Cranberry-Crimson_Queen-2017	LG09	N/A	68.4	SCF33185	View
9	Cranberry-[BG//BL/BN]95-F1	LG09	N/A	13.64	SCF33185	View
10	Cranberry-Composite_map-F1	LG09	N/A	11.64	SCF33185	View
11	Cranberry-Crimson_Queen-F1	LG09	N/A	2.98	SCF33185	View