scf28l, scf28l (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf28l
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf28l.forward primer: AACTCTTCGCTTTGGTTGGA
Primer 2scf28l.reverse primer: TCGGTCGTAGAGACGAGGAT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Unifiedmap2013LG8N/A0scf28lView
2Cranberry-Crimson_Queen-2017LG02N/A79.2scf28lView
3Cranberry-Crimson_Queen-2007LG2N/A84.5scf28lView
4Cranberry-Mullica_Queen-2017LG02N/A95.8scf28lView
5Blueberry-F1#10_x_W85-23-F1-2017LG02.1N/A18.5scf28lView
6Cranberry-CNJ02-1-2017LG02N/A87.4scf28lView
7Cranberry-Mullica_Queen-2007LG2N/A100.8scf28lView
8Blueberry-F1#10-2017LG02.1N/A15.9scf28lView
9Cranberry-CNJ02-1-2007LG2N/A91.18scf28lView
10Cranberry-Composite_map-F1LG02N/A11.31scf28lView
11Cranberry-Crimson_Queen-F1LG02N/A19.57scf28lView
12Cranberry-Mullica_Queen_1-F1LG02N/A16.86scf28lView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf28l.forward primerVaccinium macrocarponprimer
reverse primerscf28l.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf28lscf28lVaccinium macrocarponmarker_locus
scf28lscf28l-11.31Vaccinium macrocarponmarker_locus
scf28lscf28l-19.57Vaccinium macrocarponmarker_locus
scf28lscf28l-16.86Vaccinium macrocarponmarker_locus