SCF33654, SCF33654 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF33654
Genbank ID	KP279006
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)11
Primer 1	SCF33654.forward primer: CACAGCCTTAACACAGGATT
Primer 2	SCF33654.reverse primer: GTGGCTCCTTATCTGGGTA
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279006

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.