SCF3427, SCF3427 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF3427
Genbank IDKP278606
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)11
Primer 1SCF3427.forward primer: GCAAGACATCATCACAAACA
Primer 2SCF3427.reverse primer: CTTATCCCAGTCCTTCAACTTA
Max Length349
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-W85-23-2017LG06N/A39.4SCF3427View
2Cranberry-CNJ02-1-2017LG06N/A41.9SCF3427View
3Cranberry-CNJ02-1-2007LG6N/A46.04SCF3427View
4Blueberry-F1#10-2017LG06N/A49.4SCF3427View
5Blueberry-F1#10_x_W85-23-F1-2017LG06N/A42.9SCF3427View
6Cranberry-Mullica_Queen-2017LG06N/A47.3SCF3427View
7Cranberry-Mullica_Queen-2007LG6N/A56.8SCF3427View
8Cranberry-Composite_map-F1LG06N/A51.28SCF3427View
9Cranberry-Mullica_Queen_1-F1LG06N/A57.3SCF3427View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278606
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF3427.forward primerVaccinium macrocarponprimer
reverse primerSCF3427.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF3427SCF3427Vaccinium macrocarponmarker_locus
SCF3427SCF3427-51.28Vaccinium macrocarponmarker_locus
SCF3427SCF3427-57.3Vaccinium macrocarponmarker_locus