SCF29560, SCF29560 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF29560
Genbank IDKP278680
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)13
Primer 1SCF29560.forward primer: GTGTGGTGTGGTCTCTACAAT
Primer 2SCF29560.reverse primer: ACATCTCTTTGGCTGATACTTC
Max Length258
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG4N/A103.6SCF29560View
2Cranberry-Mullica_Queen-2017LG04N/A109.8SCF29560View
3Cranberry-CNJ02-1-2017LG04N/A98.2SCF29560View
4Cranberry-CNJ02-1-2007LG4N/A97.29SCF29560View
5Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG4N/A115.55SCF29560View
6Cranberry-[BG//BL/BN]95-F1LG04N/A88.87SCF29560View
7Cranberry-Composite_map-F1LG04N/A85.7SCF29560View
8Cranberry-GH1/35-F1LG04N/A85.24SCF29560View
9Cranberry-Mullica_Queen_1-F1LG04N/A115.69SCF29560View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278680
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF29560.forward primerVaccinium macrocarponprimer
reverse primerSCF29560.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF29560SCF29560Vaccinium macrocarponmarker_locus
SCF29560SCF29560-88.87Vaccinium macrocarponmarker_locus
SCF29560SCF29560-85.7Vaccinium macrocarponmarker_locus
SCF29560SCF29560-85.24Vaccinium macrocarponmarker_locus
SCF29560SCF29560-115.69Vaccinium macrocarponmarker_locus