SCF29735, SCF29735 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF29735
Genbank IDKP278681
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TG)16
Primer 1SCF29735.forward primer: CGTAAAATCTGTTGTCTCTGTG
Primer 2SCF29735.reverse primer: TCTCTATGCTCCTTCCACTTAT
Max Length278
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278681
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Vmac_chr01supercontigVmac_chr01:46277973..46278226 .Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequenceGDV marker alignment to genome using primer sequences
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A7.4SCF29735View
2Cranberry-Crimson_Queen-2007LG1N/A4.8SCF29735View
3Cranberry-Mullica_Queen-2007LG1N/A8.2SCF29735View
4Cranberry-CNJ02-1-2017LG01N/A6.9SCF29735View
5Cranberry-Crimson_Queen-2017LG01N/A4.6SCF29735View
6Cranberry-Mullica_Queen-2017LG01N/A7.3SCF29735View
7Cranberry-Composite_map-F1LG01N/A108.1SCF29735View
8Cranberry-Crimson_Queen-F1LG01N/A75.72SCF29735View
9Cranberry-Mullica_Queen_1-F1LG01N/A99.2SCF29735View