SCF29735, SCF29735 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF29735
Genbank IDKP278681
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TG)16
Primer 1SCF29735.forward primer: CGTAAAATCTGTTGTCTCTGTG
Primer 2SCF29735.reverse primer: TCTCTATGCTCCTTCCACTTAT
Max Length278
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2017LG01N/A7.3SCF29735ViewN/A
2Cranberry-Mullica_Queen-2007LG1N/A8.2SCF29735ViewN/A
3Cranberry-Crimson_Queen-2017LG01N/A4.6SCF29735ViewN/A
4Cranberry-Crimson_Queen-2007LG1N/A4.8SCF29735ViewN/A
5Cranberry-CNJ02-1-2007LG1N/A7.4SCF29735ViewN/A
6Cranberry-CNJ02-1-2017LG01N/A6.9SCF29735ViewN/A
7Cranberry-Composite_map-F1LG01N/A108.1SCF29735ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A75.72SCF29735ViewN/A
9Cranberry-Mullica_Queen_1-F1LG01N/A99.2SCF29735ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278681
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF29735.forward primerVaccinium macrocarponprimer
reverse primerSCF29735.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF29735SCF29735Vaccinium macrocarponmarker_locus
SCF29735SCF29735-108.1Vaccinium macrocarponmarker_locus
SCF29735SCF29735-75.72Vaccinium macrocarponmarker_locus
SCF29735SCF29735-99.2Vaccinium macrocarponmarker_locus