SCF29735, SCF29735 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDKP278681
SpeciesVaccinium macrocarpon
Repeat Motif(TG)16
Primer 1SCF29735.forward primer: CGTAAAATCTGTTGTCTCTGTG
Primer 2SCF29735.reverse primer: TCTCTATGCTCCTTCCACTTAT
Max Length278
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
External references for this genetic_marker

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF29735.forward primerVaccinium macrocarponprimer
reverse primerSCF29735.reverse primerVaccinium macrocarponprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF29735SCF29735Vaccinium macrocarponmarker_locus
SCF29735SCF29735-108.1Vaccinium macrocarponmarker_locus
SCF29735SCF29735-75.72Vaccinium macrocarponmarker_locus
SCF29735SCF29735-99.2Vaccinium macrocarponmarker_locus