SCF3551, SCF3551 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF3551
Genbank IDKP278608
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AC)9
Primer 1SCF3551.forward primer: CTTCGACGTTTCTGTGACTAT
Primer 2SCF3551.reverse primer: AGTTGGTGATTGGAAGAGTAAG
Max Length289
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG1N/A93.53SCF3551ViewN/A
2Cranberry-Crimson_Queen-2017LG01N/A81.2SCF3551ViewN/A
3Cranberry-Mullica_Queen_1-F1LG01N/A0SCF3551ViewN/A
4Cranberry-Mullica_Queen-2017LG01N/A94.1SCF3551ViewN/A
5Cranberry-Crimson_Queen-2007LG1N/A79.2SCF3551ViewN/A
6Cranberry-Crimson_Queen-F1LG01N/A0SCF3551ViewN/A
7Cranberry-Mullica_Queen-2007LG1N/A106.6SCF3551ViewN/A
8Cranberry-CNJ02-1-2017LG01N/A86.8SCF3551ViewN/A
9Cranberry-Composite_map-F1LG01N/A18.41SCF3551ViewN/A
10Cranberry-Mullica_Queen_2-F1LG01N/A13.49SCF3551ViewN/A
11Cranberry-Stevens-F1LG01N/A13.46SCF3551ViewN/A
12Cranberry-BB/CQ-F1LG09N/A76.73SCF3551ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278608
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF3551.forward primerVaccinium macrocarponprimer
reverse primerSCF3551.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF3551SCF3551Vaccinium macrocarponmarker_locus
SCF3551SCF3551-18.41Vaccinium macrocarponmarker_locus
SCF3551SCF3551-13.49Vaccinium macrocarponmarker_locus
SCF3551SCF3551-13.46Vaccinium macrocarponmarker_locus
SCF3551SCF3551-76.732Vaccinium macrocarponmarker_locus