SCF3595, SCF3595 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF3595
Genbank IDKP278607
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CA)10
Primer 1SCF3595.forward primer: AGACTACAGTGAACAAAGACCA
Primer 2SCF3595.reverse primer: CTGACTTGGTGTGATTAGTGAG
Max Length332
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG2N/A46.01SCF3595ViewN/A
2Cranberry-CNJ02-1-2017LG02N/A47.4SCF3595ViewN/A
3Cranberry-Crimson_Queen-2007LG2N/A45SCF3595ViewN/A
4Cranberry-Mullica_Queen-2007LG2N/A54.6SCF3595ViewN/A
5Cranberry-Crimson_Queen-2017LG02N/A41.5SCF3595ViewN/A
6Cranberry-CNJ02-1-2007LG2N/A48.87SCF3595ViewN/A
7Cranberry-Mullica_Queen-2017LG02N/A50.5SCF3595ViewN/A
8Cranberry-[BG//BL/BN]95-F1LG02N/A53.67SCF3595ViewN/A
9Cranberry-Composite_map-F1LG02N/A54.75SCF3595ViewN/A
10Cranberry-Crimson_Queen-F1LG02N/A57.25SCF3595ViewN/A
11Cranberry-Mullica_Queen_1-F1LG02N/A65.28SCF3595ViewN/A
12Cranberry-Mullica_Queen_2-F1LG02N/A66SCF3595ViewN/A
13Cranberry-Stevens-F1LG02N/A44.87SCF3595ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278607
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF3595.forward primerVaccinium macrocarponprimer
reverse primerSCF3595.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF3595SCF3595Vaccinium macrocarponmarker_locus
SCF3595SCF3595-53.67Vaccinium macrocarponmarker_locus
SCF3595SCF3595-54.75Vaccinium macrocarponmarker_locus
SCF3595SCF3595-57.25Vaccinium macrocarponmarker_locus
SCF3595SCF3595-65.28Vaccinium macrocarponmarker_locus
SCF3595SCF3595-66Vaccinium macrocarponmarker_locus
SCF3595SCF3595-44.87Vaccinium macrocarponmarker_locus