SCF36745, SCF36745 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF36745
Genbank IDKP278698
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)14
Primer 1SCF36745.forward primer: TCCTCATTAAGTATTGGACAGG
Primer 2SCF36745.reverse primer: CTGGATTCTTGTTCTTAGCTTC
Max Length316
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG7N/A17.87SCF36745View
2Cranberry-CNJ02-1-2017LG07N/A75.2SCF36745View
3Cranberry-Crimson_Queen-2017LG07N/A68.4SCF36745View
4Cranberry-Mullica_Queen-2017LG07N/A85.2SCF36745View
5Cranberry-CNJ02-1-2007LG7N/A78.88SCF36745View
6Blueberry-F1#10_x_W85-23-F1-2017LG07N/A77.7SCF36745View
7Blueberry-W85-23-2017LG07N/A66.6SCF36745View
8Cranberry-Mullica_Queen-2007LG7N/A90.4SCF36745View
9Blueberry-F1#10-2017LG07N/A80SCF36745View
10Cranberry-Crimson_Queen-2007LG7N/A70.6SCF36745View
11Cranberry-[BG//BL/BN]95-F1LG07N/A15.91SCF36745View
12Cranberry-Composite_map-F1LG07N/A16.77SCF36745View
13Cranberry-Crimson_Queen-F1LG07N/A17.29SCF36745View
14Cranberry-Mullica_Queen_1-F1LG07N/A20.92SCF36745View
15Cranberry-Mullica_Queen_2-F1LG07N/A19.53SCF36745View
16Cranberry-Stevens-F1LG07N/A8.96SCF36745View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278698
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF36745.forward primerVaccinium macrocarponprimer
reverse primerSCF36745.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fruit widthqFWID.GRYG.LG07.15Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF36745SCF36745Vaccinium macrocarponmarker_locus
SCF36745SCF36745-15.91Vaccinium macrocarponmarker_locus
SCF36745SCF36745-16.77Vaccinium macrocarponmarker_locus
SCF36745SCF36745-17.29Vaccinium macrocarponmarker_locus
SCF36745SCF36745-20.92Vaccinium macrocarponmarker_locus
SCF36745SCF36745-19.53Vaccinium macrocarponmarker_locus
SCF36745SCF36745-8.96Vaccinium macrocarponmarker_locus