SCF41971, SCF41971 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF41971
Genbank IDKP278709
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)12
Primer 1SCF41971.forward primer: ATACTTGACCTCTATGGCTTGA
Primer 2SCF41971.reverse primer: GTACTTACGTGTTTGGTTCGTT
Max Length300
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG09N/A1.4SCF41971View
2Cranberry-CNJ02-1-2007LG9N/A6.39SCF41971View
3Cranberry-CNJ02-1-2017LG09N/A0.7SCF41971View
4Cranberry-Mullica_Queen-2017LG09N/A0SCF41971View
5Cranberry-Crimson_Queen-2007LG9N/A7.4SCF41971View
6Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG9N/A6.97SCF41971View
7Cranberry-Mullica_Queen-2007LG9N/A5.3SCF41971View
8Cranberry-[BG//BL/BN]95-F1LG09N/A92.81SCF41971View
9Cranberry-Composite_map-F1LG09N/A88.51SCF41971View
10Cranberry-Crimson_Queen-F1LG09N/A68.57SCF41971View
11Cranberry-GH1/35-F1LG09N/A87.58SCF41971View
12Cranberry-Mullica_Queen_1-F1LG09N/A103.14SCF41971View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278709
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF41971.forward primerVaccinium macrocarponprimer
reverse primerSCF41971.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF41971SCF41971Vaccinium macrocarponmarker_locus
SCF41971SCF41971-92.81Vaccinium macrocarponmarker_locus
SCF41971SCF41971-88.51Vaccinium macrocarponmarker_locus
SCF41971SCF41971-68.57Vaccinium macrocarponmarker_locus
SCF41971SCF41971-87.58Vaccinium macrocarponmarker_locus
SCF41971SCF41971-103.14Vaccinium macrocarponmarker_locus