SCF39242, SCF39242 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF39242
Genbank IDKP278705
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)14
Primer 1SCF39242.forward primer: ACTCCTGAAGAAGAAGAACAGA
Primer 2SCF39242.reverse primer: AATGAATGCAGACCACAGAT
Max Length276
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2007LG1N/A10.6SCF39242ViewN/A
2Cranberry-Mullica_Queen-2017LG01N/A10.1SCF39242ViewN/A
3Cranberry-Crimson_Queen-2017LG01N/A4.6SCF39242ViewN/A
4Cranberry-CNJ02-1-2007LG1N/A8.81SCF39242ViewN/A
5Cranberry-Crimson_Queen-2007LG1N/A5.2SCF39242ViewN/A
6Cranberry-CNJ02-1-2017LG01N/A8.4SCF39242ViewN/A
7Cranberry-Composite_map-F1LG01N/A106.91SCF39242ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A74.53SCF39242ViewN/A
9Cranberry-Mullica_Queen_1-F1LG01N/A95.04SCF39242ViewN/A
10Cranberry-BB/CQ-F1LG09N/A122.34SCF39242ViewN/A
11Cranberry-BB/CQ-F1LG09N/A3.6SCF39242ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278705
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF39242.forward primerVaccinium macrocarponprimer
reverse primerSCF39242.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF39242SCF39242Vaccinium macrocarponmarker_locus
SCF39242SCF39242-106.91Vaccinium macrocarponmarker_locus
SCF39242SCF39242-74.53Vaccinium macrocarponmarker_locus
SCF39242SCF39242-95.04Vaccinium macrocarponmarker_locus
SCF39242SCF39242-122.343Vaccinium macrocarponmarker_locus
SCF39242SCF39242-3.604Vaccinium macrocarponmarker_locus