SCF42332, SCF42332 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF42332
Genbank ID	KP278710
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)10
Primer 1	SCF42332.forward primer: GATAGAATGACGAAACTAACCC
Primer 2	SCF42332.reverse primer: AGTGGGGAGATAATTGAGAAG
Max Length	208
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278710

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold00329	supercontig	scaffold00329:111524..111695 .
Vmac_chr08	supercontig	Vmac_chr08:15792125..15792306 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.